 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 18, 2012 |
| Title |
H3 K9Ac uninduced (iRunxHE-dox) |
| Sample type |
SRA |
| |
|
| Source name |
differentiating murine hematopoietic cells
|
| Organism |
Mus musculus |
| Characteristics |
strain: 129P2/OlaHsd
cell type: hemogenic endothelium
chip antibody: H3 K9Ac
chip antibody vendor: Abcam
chip antibody cat. #: ab4441
chip antibody lot #: GR25683-1
|
| Treatment protocol |
Hemogenic endothelium (HE) cells were treated for an overnight period with 0.3 µl/ml doxycycline to induce the expression of Runx1 (Tet-on system)
|
| Growth protocol |
A single cell suspension of ES cells was transferred into IVD media (IMDM with 15 % FCS, Pen/Strep, 1 mM glutamine, 0.15 mM MTG, 0.18 mg/ml human transferrin (Roche 652202) and 50 µg/ml ascorbic acid) on 15 cm low adherence bacteriological plates (Sterilin) at a concentration of 2.5 X 104/ml. After 3.25 days embryoid bodies were collected and dissociated by digested with 1 x trypsin/EDTA. The cell suspension was re-suspended in IMDM + 20 % FCS. Flk-1+ (CD309) cells were isolated using a biotinylated Flk-1 antibody (eBioscience 13-5821) used at 5 µl per 107 cells for 10 minutes on ice, followed by 2x wash with MACS buffer (PBS + 5 % BSA and 0.5 mM EDTA). Cells bound by the antibody were then isolated using antibiotin beads and MACS LS columns (Miltenyi Biotec) according to the manufacturers instructions. Purified Flk-1+ve cells were plated in blast media (IMDM supplemented with 10% FCS, Pen/Strep, 1 mM glutamine, 0.45 mM MTG, 0.18 mg/ml human transferrin, 25 µg/ml Ascorbic acid, 20 % D4T conditioned media, 5 µg/L mVEGF (Peprotech), 10 µg/L mIL-6 (Miltenyi Biotec)) at a concentration of 8-10 X103/cm2 on gelatinized tissue culture treated dishes. D4T conditioned media was made by growing confluent D4T cells in fresh IMDM media supplemented with 10 % FCS, Pen/Strep, 1 mM glutamine, 0.15 mM MTG and 50 ng/ml acidic human FGF (R&D Sytems) for 3-4 days. After 2-2.5 days cells were trypsinised, again MACS sorted for Flk-1+ cells as described before and 2x104/ cm2 Flk-1+ cells were plated on gelatin coated tissue culture plates and cultured for 2 days. Hemogenic endothelium media – IMDM supplemented with 10 % FCS, Pen/Strep, 1 mM glutamine, 0.15 mM MTG, 0.18 mg/ml human transferrin, 25 µg/ml Ascorbic acid, Oncostatin 10 µg/ml (R&D Systems 495-MO), basic mFGF 1 µg/ml (Peprotech 450-33), mSCF 10 µg/ml (Peprotech 500-P71).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Libraries of DNA fragments from chromatin immunoprecipitation were prepared from approximately 10 ng of DNA. Firstly, overhangs were repaired by treatment of sample material with T4 DNA polymerase, T4 PNK and Klenow DNA polymerase (all enzymes obtained from New England Biolabs UK) in a reaction also containing 50 mM Tris-HCl,10 mM MgCl2, 10 mM Dithiothreitol, 0.4 mM dNTPs and 1 mM ATP. Samples were purified after each step using Qiagen MinElute columns (according to the manufacturer’s guidelines). ‘A’ bases were added to 3’ ends of fragments using Klenow Fragment (3´- 5´ exo-), allowing for subsequent ligation of adapter oligonucleotides (Illumina part #1000521) using Quick T4 DNA ligase. After a further column clean up to remove excess adaptors, fragments were amplified in an 18-cycle PCR reaction using adapter-specific primers (5’-CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T and 5’-AATGATACGGCGACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA*T. The libraries were purified and adapter dimers removed by running the PCR products on 2% agarose gels and excising gel slices corresponding to fragments approximately 200-300 bp in size, which were then extracted using the Qiagen gel extraction kit. Libraries were validated using quantitative PCR for known targets, and quality assessed by running 1 µl of each sample on an Agilent Technologies 2100 Bioanalyser. Once prepared, DNA libraries were subject to massively parallel DNA sequencing on an Illumina Genome Analyzer.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
without induction
|
| Data processing |
The reads in fastq format were aligned to mm9 using bowtie-0.12.7 (output in SAM format). The SAM files were converted to BED and ELAND formats using in-house scripts - Peaks were calculated from the eland files using the peak finding program MACS-1.4.2 with the following parameters: mfold=10,16 -bw=100 -pvalue=1e-9 -gsize=1870000000
bedGraphs created in-house
Genome_build: mm9
Supplementary_files_format_and_content: Bed and bedGraph – aligned reads and read density profiles
|
| |
|
| Submission date |
Aug 20, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Rebecca Louise Hannah |
| E-mail(s) |
rlh60@cam.ac.uk, rebeccahannah@live.co.uk
|
| Organization name |
University of Cambridge
|
| Department |
Haematology
|
| Street address |
Addenbrookes Hospital, Hills Road
|
| City |
Cambridge |
| ZIP/Postal code |
CB2 0XY |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL11002 |
| Series (1) |
| GSE40235 |
RUNX1 reshapes the epigenetic landscape at the onset of hematopoiesis |
|
| Relations |
| SRA |
SRX180162 |
| BioSample |
SAMN01121731 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM989020_H3K9Ac_uninduced_HE-dox.bed.gz |
179.5 Mb |
(ftp)(http) |
BED |
| GSM989020_H3K9Ac_uninduced_HE-dox.bedGraph.gz |
232.3 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
