NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586214           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-10
RefSNP(rs#)rs4986820
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec/t_g
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TATTTCACTTTTCAACCACG, Temp: 45.4, GC Content:35, Product Size: 363 Primer R: ACAGGATACAGTAGAGAAGATTTG, Temp: 46.2, GC Content:37.5

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586214|allelePos=138|len=325|taxid=9606|alleles='C/T'|mol=Genomic
 ATTTGTATAA AAGAAATAGG AACAAAGCAA AGGTTAGTAC CTAAAATATA AAACCTGTCA
 ATTCAATGGA TATTGGTTTT CTGGTTTAAA TTTCCATTTA GAATTGTTTG AAATAATTTC
 AGATAGAAAT TTAAGAT
 Y
 GTAGASTAAG ACAACTTTCT CTTCATTTTT GCTAGCTTCT CTTTGACTAT GTCTATTGAG
 ATGCCGTATG TGATTGAATT CATTTTCAGT GATACACATG AACTGAAACA AAAGGTTAGT
 GCATCTTTGA TTTCTTAAGA GCTGTTATTT TAACACTACT TTTATCTTAT CAAAGCAATG
 TATGCAC

  Submitted Frequency for ss5586214 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
46C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.95800000
T=0.04200000
0.080 +/-0.075C/C=0.91700000
C/T=0.08300000
0.08308272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
08272003SNP500CANCER
P1
MULTI-NATIONAL
202C=0.99000001
T=0.01000000
0.020 +/-0.019C/C=0.98000002
C/T=0.02000000
0.02008272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
08272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586214 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586214.


  Submitted individual genotype for ss5586214 back to top
There is no individual genotype data for ss5586214.