Submitter | Handle | TAPPERS | Submitter SNP ID | CHRNA4X3_bp65_A/G | RefSNP(rs#) | rs2273502 | Submitted Batch ID | RDT2007May2 | Submitted Date | May 03, 2007 | Publication Cited | 12556914 | First entry to dbSNP | May 3 2007 12:00:00:000AM |
| Resource Links | GenBank Accession | NT_011333
| Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| Assay | Species | Homo sapiens | Molecular Type | Genomic | Method | RDT-SEQUENCING | Ascertainment Samplesize | 344 | Population | MOTWINS |
| Allele | Observed Allele | A/G | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | SNV | CpG Code | N.D. |
| | |
Comment | PCR products analyzed by DHPLC and sequencing, PCR primers used to sequence both directions;Forward primer: CCCGTCCACCATATCTTGCReverse primer: GCAGTGCCCTCCCACTCACTemplate: 50 ng genomic DNA in 10uL final volumePrimer: each 0.32uM,dNTPs:each 0.125mM (except dGTP: 0.031mM 7-deaza-GTP, 0.093mM regular dGTP), Taq Polymerase: 0.05units/ulPCR buffer: 50mM KCl, 10mM Tris pH 8.3, Mg 1.5mM3 min 30s 94.5C initial denature and 10 min 72C final extension;40 cycles: 35s at 94.5C, 35s at {66C to 58C over 10 cycles then 58C for 30 cycles}, 35s at 72C |
>gnl|dbSNP|ss71641166|allelePos=51|len=101|taxid=9606|alleles='A/G'|mol=Genomic CTTGCCCTGG CCGTGTCCTT GTGCCAGTGG CTGTAGATGA GGAAACCTAG
R
GCCAGAGAAA GACACCAAGG GGTCACTGGC CCCCTTCCTC TCTCGGTGCC
Population ID -Class | Sample (2n) | Major Allele Freq. | Minor Allele Freq. | Estimated Heterozygosity +/-std.err. | Genotype Freq. | Submitted Hetero- zygosity | Submission Batch | Submitter | MOTWINS - NORTH AMERICA | 344 | | | | G/G=0.86046499 A/G=0.13953499
| | RDT2007May2 | TAPPERS |
Population ID -Class | Total Sample (2N) | Founder (2N) | Major Allele Freq. | Minor Allele Freq. | Genotype Freq. | HWE Goodness of Fit | Data Source | MOTWINS - NORTH AMERICA | 344 | 344 | G=0.93023258
| A=0.06976745 | G/G=0.86046511 A/G=0.13953489
| Pr(chiSq=0.130,df=1) =0.752 | Genotype Freq. |
There is no individual genotype data for ss71641166.
|