Submitter | Handle | GNOMAD | Submitter SNP ID | rs1164200543 | RefSNP(rs#) | clustering in process | Submitted Batch ID | xaa.reformatted | Submitted Date | Aug 29, 2020 | Publication Cited | N.D. | First entry to dbSNP | Aug 29 2020 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| Assay | Species | Homo sapiens | Molecular Type | Genomic | Method | GNOMAD | Ascertainment Samplesize | 143404 | Population | N.D. |
| Allele | Observed Allele | -/AAGGGATGTAGGGATGATGAAGGGATGATG | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss3987672280|allelePos=26|len=51|taxid=9606|alleles='-/AAGGGATGTAGGGATGATGAAGGGATGATG'|mol=Genomic AGGGATGATG AAGGGATGAT GGATA
N
GATAAAGGGA TATAGGGATG AAGCG
There is no frequency submission for ss3987672280.
No sufficient data to compute Hardy-weinberg probability for ss3987672280.
There is no individual genotype data for ss3987672280.
|