 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 14, 2019 |
| Title |
AGO CLIP, individual 2 |
| Sample type |
SRA |
| |
|
| Source name |
postmortem BA9
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: motor cortex (BA9)
age: 50
Sex: M
postmortem interval: 20.4
storage (months): n/a
ago: rna complex: Pooled high molecular weight AGO:RNA complexes ~130-150kDa
biological replicate: replicate 2
informatic pool: pool 1
|
| Treatment protocol |
n/a
|
| Growth protocol |
n/a
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Argonaute IP, alkaline phosphatase treatment, polynucleotide kinase (PNK) radiolabeling, addition of pre-adenylated 3’ linker, SDS-PAGE, and nitrocellulose transfer and extraction performed. AGO:RNA complexes excised out of nitrocellulose membrane, followed by proteinase K digestion of AGO protein.
AGO-CLIP footprints were cloned using the Br-dU incorporation and bead-capture strategy. Barcoded reverse transcription (RT) primers, allowing multiplexing of 3 samples per Hiseq (Illumina) run,50 base pair single-end reads.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
Individual_2
|
| Data processing |
All fastq processing done using fastqx_toolkit-0.0.14 (http://hannonlab.cshl.edu/fastx_toolkit/). Sequencing reads were filtered for quality reads (min:0-6:20,mean:7-50:20), collapsed exact sequences, trimmed 5' degenerate linker, demultiplexed and trimmed 4nt barcode sequence, and clipped 3' adapter sequence (GTGTCAGTCACTTCCAGCGG).
Processed fastq files were aligned to human reference genome using novoalign (Novocraft Technologies) applying iterative 3'trimming and retaining only single-hit reads.
Due to low complexity of sequencing reads, data from individual 1-3 (pool_1) and individual 4-6 (pool_2) were pooled. Aligned reads from pool_1 and pool_2 were combined with pooled aligned reads from published human AGO CLIP data (GSE52084) (Boudreau et al., 2014), representing 11 individual replicates + 2 pooled samples, totaling 13. Peak calling strategy using CLIP Toolkit command tag2peak.pl was used, applying FDR cut-off of <0.01 over background. Genomic coordinates for each peak were constructed with standard width of 80nt (+/- 40nt from peak midpoint). Robust peaks were defined by peak height of 50 (PH50) and biological complexity of 7 (BC7), meaning each peak was represented by at least 50 independent reads made up of reads from 7 out of 13 replicates. Complete protocol detailed in referenced publication
Genome_build: hg19
Supplementary_files_format_and_content: Counts of each BC7, PH50 peak (23,662), hg19 genomic location, Boudreau et al., 2014's data of 11 patients, pool1, pool2, strand info
|
| |
|
| Submission date |
Sep 20, 2017 |
| Last update date |
Jun 14, 2019 |
| Contact name |
Mariko Kobayashi |
| E-mail(s) |
mkobayashi@rockefeller.edu
|
| Organization name |
Rockefeller University
|
| Department |
Molecular Neuro-Oncology
|
| Lab |
Robert B. Darnell
|
| Street address |
1230 York Avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL15520 |
| Series (2) |
| GSE104048 |
AGO CLIP reveals an activated network for acute regulation of brain glutamate homeostasis in ischemic stroke [dataset 6] |
| GSE104053 |
AGO CLIP reveals an activated network for acute regulation of brain glutamate homeostasis in ischemic stroke |
|
| Relations |
| BioSample |
SAMN07674767 |
| SRA |
SRX3200836 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
