GEO Profile Links for Gene (Select 18436) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2478

<< First< Prev

Page of 124

Next >Last >>

Select item 447912631.

P2rx1 - Pancreatic development (MG-U74C)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL83, 165921_r_at (ID_REF), GDS2950, 18436 (Gene ID), AV315723

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 44791263

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 215117632.

P2rx1 - Myotube response to PGC-1alpha induced mitochondrial biogenesis: time course (MG-U74C)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL83, 165921_r_at (ID_REF), GDS1880, 18436 (Gene ID), AV315723

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 21511763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 122523113.

P2rx1 - GATA-1 variant role in Down syndrome megakaryocytic leukemias

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1460719_a_at (ID_REF), GDS1316, 18436 (Gene ID), NM_008771

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 12252311

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 757131524.

P2rx1 - Cyclophosphamide effect on peripheral blood leukocytes: time course

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL13209, 011A12 (ID_REF), GDS4004, NM_008771

DataSet type:: Expression profiling by array, log2 ratio, 30 samples

ID:: 75713152

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273284635.

P2rx1 - Type 1 diabetes model: autoimmune target organs (MG-U74C)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL83, 165921_r_at (ID_REF), GDS2179, 18436 (Gene ID), AV315723

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27328463

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 169820636.

P2rx1 - Osteoblast differentiation (MG-U74C)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL83, 165921_r_at (ID_REF), GDS1633, 18436 (Gene ID), AV315723

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16982063

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 122214007.

P2rx1 - GATA-1 variant role in Down syndrome megakaryocytic leukemias

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429794_a_at (ID_REF), GDS1316, 18436 (Gene ID), AK007650

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 12221400

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447624108.

P2rx1 - Pancreatic development (MG-U74A)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL81, 103971_at (ID_REF), GDS2948, 18436 (Gene ID), X84896

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 44762410

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 109628119.

P2rx1 - GATA-1 knockdown effect on megakaryocytes

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1460719_a_at (ID_REF), GDS1245, 18436 (Gene ID), NM_008771

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 10962811

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 392676310.

P2rx1 - Intestinal tract gene expression (MG-U74C)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL83, 165921_r_at (ID_REF), GDS524, 18436 (Gene ID), AV315723

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3926763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8901500011.

P2rx1 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429794_a_at (ID_REF), GDS4408, 18436 (Gene ID), AK007650

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89015000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7562081112.

P2rx1 - Type 2 diabetic (TALLYHO/JngJ x C57BL6) F2 males: liver, pancreas, muscle and adipose tissue

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1460719_a_at (ID_REF), GDS4000, 18436 (Gene ID), NM_008771

DataSet type:: Expression profiling by array, transformed count, 64 samples

ID:: 75620811

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751240213.

P2rx1 - MPSS transcriptome analysis project

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCACAAACCCCCATGTGC (ID_REF), GDS868, NM_008771

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7512402

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 7397601114.

P2rx1 - MMTV/c-MYC transgenic model of breast cancer: peripheral blood cells

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1460719_a_at (ID_REF), GDS3953, 18436 (Gene ID), NM_008771

DataSet type:: Expression profiling by array, transformed count, 93 samples

ID:: 73976011

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7394510015.

P2rx1 - MMTV/c-MYC transgenic model of breast cancer: peripheral blood cells

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429794_a_at (ID_REF), GDS3953, 18436 (Gene ID), AK007650

DataSet type:: Expression profiling by array, transformed count, 93 samples

ID:: 73945100

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2556660016.

P2rx1 - Bladders expressing fluorescent reporters

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429794_a_at (ID_REF), GDS2099, 18436 (Gene ID), AK007650

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 25566600

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7558990017.

P2rx1 - Type 2 diabetic (TALLYHO/JngJ x C57BL6) F2 males: liver, pancreas, muscle and adipose tissue

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429794_a_at (ID_REF), GDS4000, 18436 (Gene ID), AK007650

DataSet type:: Expression profiling by array, transformed count, 64 samples

ID:: 75589900

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2729961018.

P2rx1 - Type 1 diabetes model: autoimmune target organs (MG-U74A)

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL81, 103971_at (ID_REF), GDS2177, 18436 (Gene ID), X84896

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27299610

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2559751119.

P2rx1 - Bladders expressing fluorescent reporters

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1460719_a_at (ID_REF), GDS2099, 18436 (Gene ID), NM_008771

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 25597511

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1093190020.

P2rx1 - GATA-1 knockdown effect on megakaryocytes

Annotation:: P2rx1, purinergic receptor P2X, ligand-gated ion channel, 1

Organism:: Mus musculus

Reporter:: GPL1261, 1429794_a_at (ID_REF), GDS1245, 18436 (Gene ID), AK007650

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 10931900

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 124

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 18436) (2478)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2478

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity