GEO Profile Links for Gene (Select 320159) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 973

<< First< Prev

Page of 49

Next >Last >>

Select item 368570041.

Fam179a - Multiple myeloma model

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS2640, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 36857004

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 412937042.

Fam179a - Brown and white adipose tissues

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS2813, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41293704

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 354937043.

Fam179a - Regenerating liver and developing embryonic liver comparison

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS2577, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 35493704

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824897944.

Fam179a - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2589770 (ID_REF), GDS3720, NM_177087

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82489794

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596643945.

Fam179a - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2589770 (ID_REF), GDS3522, NM_177087

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59664394

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 148888046.

Fam179a - Serum response factor null mutation effect on neonatal cardiomyocytes

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS1486, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 14888804

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 820342047.

Fam179a - Oxidative-stress induced neurodegeneration in Harlequin mutant: olfactory epithelium

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS3365, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 82034204

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 232512838.

Fam179a - Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74C)

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL83, 168041_at (ID_REF), GDS1988, 320159 (Gene ID), AV262737

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23251283

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 572877049.

Fam179a - Murine model of primary mitochondrial dysfunction

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS3454, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 57287704

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2997515010.

Fam179a - Akt1 serine-threonine protein kinase activation effect on the heart (MG-430B)

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL340, 1440898_at (ID_REF), GDS2308, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 29975150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2034660411.

Fam179a - Graded HoxA10 expression effect on Lin(-) Sca1(+) c-kit(+) bone marrow cells

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS1809, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 20346604

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11940369712.

Fam179a - Chronic, low level drug exposure effect on obese liver

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P103024 (ID_REF), GDS5258, NM_177087, A_52_P103024 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119403697

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5162390413.

Fam179a - Liver response to human and chimpanzee diets

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS3221, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 51623904

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11222460414.

Fam179a - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 7 cerebellum

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS5089, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 112224604

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4449750415.

Fam179a - Olfactory marker protein deficiency effect on the olfactory epithelium

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS2937, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 44497504

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2866730416.

Fam179a - Circadian clock deficient Per2/Cry1 double mutant adrenal gland in constant darkness: time course

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS2233, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 28667304

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2340465017.

Fam179a - Lymphotoxin-beta receptor signaling inhibition effect on lymph nodes: time course (MG-430B)

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL340, 1440898_at (ID_REF), GDS2005, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 23404650

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 851325018.

Fam179a - Asthma and interleukin 13 (MOE430B)

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL340, 1440898_at (ID_REF), GDS959, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 8513250

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746579919.

Fam179a - MPSS transcriptome analysis project

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCCTCTCAGTGCTGGT (ID_REF), GDS868, NM_177087

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7465799

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11227110420.

Fam179a - Cystatin B knockout model of progressive myoclonus epilepsy: postnatal day 30 cerebellum

Annotation:: Fam179a, family with sequence similarity 179, member A

Organism:: Mus musculus

Reporter:: GPL1261, 1440898_at (ID_REF), GDS5090, 320159 (Gene ID), BB474395

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 112271104

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 49

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 320159) (973)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 973

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity