GEO Profile Links for Gene (Select 78306) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 26

<< First< Prev

Page of 2

Next >Last >>

Select item 1304371201.

Tsga10ip - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5666, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130437120

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728270202.

Tsga10ip - Spatial and temporal development of mammalian salivary glands

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS3922, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72827020

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1284545203.

Tsga10ip - Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5612, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128454520

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1316303204.

Tsga10ip - Normal liver developmental stages: embryonic and postnatal

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5818, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131630320

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 188058095.

MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Transcribed locus, strongly similar to XP_003086157.2 PREDICTED: testis-spec...

Organism:: Mus musculus

Reporter:: GPL2897, 361089 (ID_REF), GDS1729, BY707546

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18805809

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1284119206.

Tsga10ip - Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5611, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 128411920

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 414334097.

Nephronophthisis model

Annotation:: Transcribed locus, strongly similar to XP_003086157.2 PREDICTED: testis-spec...

Organism:: Mus musculus

Reporter:: GPL2897, 361089 (ID_REF), GDS2817, BY707546

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41433409

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 468295728.

Dicer inactivation effect on the embryonic heart

Annotation:: Transcribed locus, strongly similar to XP_003086157.2 PREDICTED: testis-spec...

Organism:: Mus musculus

Reporter:: GPL5025, 32072 (ID_REF), GDS3033, BY707546

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46829572

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 203788079.

Surgical model of acute lymphedema induction

Annotation:: Transcribed locus, strongly similar to XP_003086157.2 PREDICTED: testis-spec...

Organism:: Mus musculus

Reporter:: GPL3506, 26593 (ID_REF), GDS1810, AV053404, 1810026P05 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 9 samples

ID:: 20378807

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12265982010.

Tsga10ip - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5343, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122659820

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6249701011.

Tsga10ip - Primary coenzyme Q deficient liver response to probucol (WG-6 2.0)

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL9526, AFFYCUSTOMHF3643 (ID_REF), GDS3619, Tsga10ip (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 62497010

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1561188512.

Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Transcribed locus, strongly similar to XP_003086157.2 PREDICTED: testis-spec...

Organism:: Mus musculus

Reporter:: GPL2727, 26593 (ID_REF), GDS1527, AV053404, 1810026P05 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15611885

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11966612013.

Tsga10ip - High-fat diet effect on obesity-resistant NAG-1 transgenics: colon epithelium

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5264, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 119666120

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11824092014.

Tsga10ip - Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5228, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 118240920

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12090562015.

Tsga10ip - T helper type 9 cells

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5291, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120905620

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9214760116.

Tsga10ip - CD-1 neuronal stem cell response to microRNA-128 mimic

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL13455, XM_003085377_at (ID_REF), GDS4415, XM_003085377

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92147601

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6403952017.

Tsga10ip - SIRT1 deficiency effect on the liver

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS3666, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64039520

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 762750018.

MPSS analysis of BLK CL.4 and liver cells

Annotation:: Transcribed locus, strongly similar to XP_003086157.2 PREDICTED: testis-spec...

Organism:: Mus musculus

Reporter:: GPL1010, GATCACTTAGAGCAGAAATG (ID_REF), GDS878, BY707546

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7627500

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12912882019.

Tsga10ip - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P293736 (ID_REF), GDS5629, XM_003085377, A_51_P293736 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129128820

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6245273620.

Tsga10ip - Primary coenzyme Q deficient liver response to probucol (Gene 1.0 ST)

Annotation:: Tsga10ip, testis specific 10 interacting protein

Organism:: Mus musculus

Reporter:: GPL9525, AFFYCUSTOMHF26078 (ID_REF), GDS3618, Tsga10ip (ORF)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 62452736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 78306) (26)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 26

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity