GEO Profiles Links for Nucleotide (Select 59808026) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 298

<< First< Prev

Page of 15

Next >Last >>

Select item 1078574921.

Rsl24d1 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS4944, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107857492

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1078428422.

Rsl24d1 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10454063 (ID_REF), GDS4944, NM_198609, BC003885, BC089481, chr18:14570113-14571716 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107842842

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74660913.

Rsl24d1 - MPSS transcriptome analysis project

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTTGCCTCCTGAGTT (ID_REF), GDS868, BC089481

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7466091

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1268367924.

Rsl24d1 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS5456, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126836792

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 875092925.

Rsl24d1 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS4317, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87509292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1219217926.

Rsl24d1 - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS5316, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121921792

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1219071427.

Rsl24d1 - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10454063 (ID_REF), GDS5316, NM_198609, BC003885, BC089481, chr18:14570113-14571716 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121907142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 881339928.

Rsl24d1 - Sox9+ pancreatic cells: developmental time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS4335, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88133992

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 874946429.

Rsl24d1 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10454063 (ID_REF), GDS4317, NM_198609, BC003885, BC089481, chr18:14570113-14571716 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87494642

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11440959210.

Rsl24d1 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS4948, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114409592

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13023797011.

Rsl24d1 - Interleukin 7 and FLT-3 ligand effect on EML1 HSPC line expressing acute lymphoblastic leukemia TEL-AML1 fusion protein: time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL11533, 10587042 (ID_REF), GDS5661, NM_198609, BC089481, chr9:72961279-72971047 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130237970

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11437289212.

Rsl24d1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS4946, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114372892

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10871189213.

Rsl24d1 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS4973, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108711892

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8811934214.

Rsl24d1 - Sox9+ pancreatic cells: developmental time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10454063 (ID_REF), GDS4335, NM_198609, BC003885, BC089481, chr18:14570113-14571716 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88119342

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11439494215.

Rsl24d1 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10454063 (ID_REF), GDS4948, NM_198609, BC003885, BC089481, chr18:14570113-14571716 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114394942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11435824216.

Rsl24d1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10454063 (ID_REF), GDS4946, NM_198609, BC003885, BC089481, chr18:14570113-14571716 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114358242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13070529217.

Rsl24d1 - Glucagon effect on hepatocytes deficient in lysine acetyltransferase 2B or WD repeat-containing protein 5

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS5673, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 130705292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12569529218.

Rsl24d1 - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS5421, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125695292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11830099219.

Rsl24d1 - Adam10 deficiency effect on the epidermis

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS5229, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118300992

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11606869220.

Rsl24d1 - Bcl6 deficiency effect on regulatory T cell

Annotation:: Rsl24d1, ribosomal L24 domain containing 1

Organism:: Mus musculus

Reporter:: GPL6246, 10587042 (ID_REF), GDS5161, NM_198609, BC003885, BC089481, chr9:73113472-73123240 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116068692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 59808026) (298)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 298

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity