Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 1149

1.
Value/Rank Plot

Caml - Wnt4 mutation effect on female embryonic gonads

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL3108, 1176 (ID_REF), GDS2574, NM_007596
DataSet type:
Expression profiling by array, log2 ratio, 4 samples
2.
Value/Rank Plot

Caml - Hematopoietic cells at various stages of differentiation

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS2398, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 4 samples
3.
Value/Rank Plot

Caml - ROR alpha1 deletion effect on skeletal muscle

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL6105, ILMN_2728034 (ID_REF), GDS3720, NM_007596
DataSet type:
Expression profiling by array, transformed count, 6 samples
4.
Value/Rank Plot

Caml - Homeodomain interacting protein kinase 2 dominant-negative form effect on trigeminal ganglion

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS1793, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 8 samples
5.
Value/Rank Plot

Caml - 5-azacytidine effect on mesenchymal progenitor cell line

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS5519, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 6 samples
6.
Value/Rank Plot

Caml - Neuron-specific T-box transcription factor deficiency effect on embryonic day 16.5 forebrains

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS5389, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 8 samples
7.
Value/Rank Plot

Caml - Suprachiasmatic nucleus response to a light pulse

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL8321, 1417842_at (ID_REF), GDS3107, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 6 samples
8.
Value/Rank Plot

Caml - Carotid body and genetic background

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS2466, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 6 samples
9.
Value/Rank Plot

Caml - Transcription factor Nrl deficiency effect on photoreceptor development

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS1693, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 39 samples
10.
Value/Rank Plot

Caml - Nodose and dorsal root ganglia comparison (MG-430 2.0)

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS1635, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 20 samples
11.
Value/Rank Plot

Caml - MPSS transcriptome analysis project

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1010, GATCAACCGGTCCATGGACA (ID_REF), GDS868, NM_007596
DataSet type:
Expression profiling by MPSS, count, 87 samples
12.
Value/Rank Plot

Caml - Mutant transcription factor ThPOK effect on memory P14 T cells

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS3566, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 4 samples
13.
Value/Rank Plot

Caml - Chemokine receptor CXCR7 deficiency effect on neonatal semilunar valves

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS3183, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 4 samples
14.
Value/Rank Plot

Caml - Endothelin-1 effect on dermal fibroblasts

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS1980, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 6 samples
15.
Value/Rank Plot

Caml - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P521161 (ID_REF), GDS5629, NM_007596, A_51_P521161 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
16.
Value/Rank Plot

Caml - Wild type embryonic tooth germ tissue

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS4453, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 6 samples
17.
Value/Rank Plot

Caml - Amyotrophic lateral sclerosis model

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL339, 1417842_at (ID_REF), GDS3408, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 18 samples
18.
Value/Rank Plot

Caml - Trib1-deficient macrophage response to lipopolysaccharide

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS2944, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 4 samples
19.
Value/Rank Plot

Caml - Homeodomain protein Lim1 deficiency effect on embryonic renal vesicles

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL1261, 1417842_at (ID_REF), GDS2748, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 9 samples
20.
Value/Rank Plot

Caml - Fibrillin-1 deficiency effect on heart mitral valves

Annotation:
Caml, calcium modulating ligand
Organism:
Mus musculus
Reporter:
GPL339, 1417842_at (ID_REF), GDS856, 12328 (Gene ID), NM_007596
DataSet type:
Expression profiling by array, count, 4 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center