|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Dec 10, 2020 |
Title |
GC4_DZ_A04.DecP.30_H.DZ |
Sample type |
SRA |
|
|
Source name |
Germinal Centers
|
Organism |
Mus musculus |
Characteristics |
dec: Dec_Positive timepoint: 30_Hours zone: Dark_Zone sequencing: 1dec genotype: NA
|
Extracted molecule |
total RNA |
Extraction protocol |
Cell suspensions were resuspended in PBE and incubated on ice for 30 min with fluorescently-labeled antibodies (Table S2) along with 1 mg/mL of anti-CD16/32 (24G2, eBioscience). For detection of cells in early S of the cell cycle, we performed dual nucleotide pulse and staining as previously described (Gitlin et al., 2014). Briefly, mice were injected i.v. with 1 mg of EdU (A10044, Thermo Fisher Scientific) and one hour later with 2 mg of BrdU (B5002, Sigma). 30 min after the second injection, lymph nodes were harvested, and single cell suspensions were prepared. After cell surface receptor staining as described above, cells were fixed and permeabilized using BD Cytofix/Cytoperm™ fixation and permeabilization solution and BD Cytoperm Permeabilization Buffer PLUS, respectively. EdU and BrdU incorporation into DNA was assayed using the Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Invitrogen) and FITC BrdU Flow Kit (BD), respectively. For single cell sorting, cells were stained as above and index-sorted directly into 96 well plates containing Buffer TCL (Qiagen) supplemented with 1% -mercaptoethanol using a BD FACS Aria II. Each plate contained all conditions assayed in each replicate. Cells were washed, filtered, and resuspended in PBE prior to analysis or sorting on BD FACS LSR II, FACS Symphony or FACS ARIA II cytometers. All data were analyzed using Flowjo software v.10. Libraries were prepared as previously described (Trombetta et al., 2014). Briefly, nucleic acids were extracted from sorted single cell using RNAClean XP SPRI beads (Beckman Coulter), and RNA was hybridized first using RT primer (/5BiosG/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN) then reverse-transcribed into cDNA using TSO primer (AAGCAGTGGTATCAACGCAGAGTACATrGrGrG) and RT maxima reverse transcriptase (Thermo Fisher Scientific). cDNA was amplified using ISPCR primer (AAGCAGTGGTATCAACGCAGAGT) and KAPA HiFi HotStart ReadyMix (Fisher Scientific), cleaned up using RNAClean XP SPRI beads three times, and tagmented using Nextera XT DNA Library Preparation Kit (Illumina). For each sequencing batch, up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally, dual-barcoded libraries were pooled and sequenced using Illumina Hiseq2500 (experiment 1)/Nextseq 550 (experiments 2-4) platform. Smartseq2
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
1dec_07082018-scRNAseq.txt.gz GC4_DZ_A04
|
Data processing |
Raw fastq sequence files generated from Smartseq2 libraries were aligned to mouse genome (v. mm10) with the annotated transcriptome (v. gencode M22) using STAR (v. 2.6)(Dobin et al., 2013). Subsequently, genome-mapped BAM files were processed through RSEM (v. 1.3.1)(Li and Dewey, 2011) for gene quantification. The matrix of gene counts was then, used as input for analysis by the R package Seurat (v. 3.1.4.)(Stuart et al., 2019). Next, the dataset was corrected by using the regularized negative binomial regression (SCTransform) implemented by Seurat (Hafemeister and Satija, 2019). To control the dataset for unwanted sources of experimental variation, we fed the mitochondrial gene abundance and the experimental batches information into SCTransform. Additionally, cells containing more than 20% of sequence reads aligned to mitochondrial genes were excluded prior to normalization. Next, single cells were clustered and gene expression were evaluated with the Seurat workflow. Gene signature scoring was performed by using Seurat’s AddModuleScore function (See Supplemental Spreadsheet 1 for the complete list). Genome_build: mm10 Supplementary_files_format_and_content: txt files contain raw, individual quantification matrices per experiment Supplementary_files_format_and_content: tsv files contain metadata tables, umap/pca embeddings, and quality filtered raw and normalized quantification
|
|
|
Submission date |
Nov 25, 2020 |
Last update date |
Dec 10, 2020 |
Contact name |
Gabriel Victora |
E-mail(s) |
gvictora@rockefeller.edu
|
Organization name |
The Rockefeller University
|
Street address |
1230 York Avenue
|
City |
New York |
State/province |
NY |
ZIP/Postal code |
10065 |
Country |
USA |
|
|
Platform ID |
GPL17021 |
Series (1) |
GSE162182 |
Cyclin D3 drives inertial cell cycling in dark zone germinal center B cells |
|
Relations |
BioSample |
SAMN16915410 |
SRA |
SRX9586000 |
Supplementary data files not provided |
SRA Run Selector |
Processed data are available on Series record |
Raw data are available in SRA |
|
|
|
|
|