GEO Profile Links for Gene (Select 11775) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2195

<< First< Prev

Page of 110

Next >Last >>

Select item 84182651.

Ap3b2 - Lacrimal gland and cornea burn: time course (SMCmou6600Av2)

Annotation:: Ap3b2, Adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1232, 13465 (ID_REF), GDS949, BG072491

DataSet type:: Expression profiling by array, log ratio, 29 samples

ID:: 8418265

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 84030652.

Ap3b2 - Lacrimal gland and cornea burn: time course (SMCmou6600Av1)

Annotation:: Ap3b2, Adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1231, 13465 (ID_REF), GDS948, BG072491

DataSet type:: Expression profiling by array, log ratio, 18 samples

ID:: 8403065

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83957053.

Ap3b2 - Lacrimal gland and cornea burn: time course (SMCmou6600Av1)

Annotation:: Ap3b2, Adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1231, 6105 (ID_REF), GDS948, BG072491

DataSet type:: Expression profiling by array, log ratio, 18 samples

ID:: 8395705

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 925784334.

Ap3b2 - Homeobox transcription factor Dlx5 deficiency effect on embryonic otic vesicle

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1426927_at (ID_REF), GDS4443, 11775 (Gene ID), AB030202

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 92578433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 285175175.

Ap3b2 - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL2987, 4817 (ID_REF), GDS2227, AB030202

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28517517

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 264545336.

Ap3b2 - PGC-1alpha null brown adipocyte response to cAMP

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1426927_at (ID_REF), GDS2149, 11775 (Gene ID), AB030202

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 26454533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 84109057.

Ap3b2 - Lacrimal gland and cornea burn: time course (SMCmou6600Av2)

Annotation:: Ap3b2, Adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1232, 6105 (ID_REF), GDS949, BG072491

DataSet type:: Expression profiling by array, log ratio, 29 samples

ID:: 8410905

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 417580408.

Ap3b2 - Sickle cell anemia model: brain response to naloxone

Annotation:: Ap3b2, Adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL4464, 72b12 (ID_REF), GDS2826, AI848762

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 41758040

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159420369.

Ap3b2 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3009184 (ID_REF), GDS5157, NM_021492, AP3B2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115942036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2321876510.

Ap3b2 - Primary visual cortex response to visual input deprivation (MG-U74C)

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL83, 131020_at (ID_REF), GDS1986, 11775 (Gene ID), AW121779

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23218765

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7316687111.

Ap3b2 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3009184 (ID_REF), GDS3932, NM_021492

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73166871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5530126512.

Ap3b2 - Visual cortex during the critical period for ocular dominance (MG-U74C)

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL83, 131020_at (ID_REF), GDS3382, 11775 (Gene ID), AW121779

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55301265

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3701183313.

Ap3b2 - Asthma model: lungs

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1261, 1426927_at (ID_REF), GDS2647, 11775 (Gene ID), AB030202

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37011833

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2322289714.

Ap3b2 - Primary visual cortex response to visual input deprivation (MG-U74C)

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL83, 139173_at (ID_REF), GDS1986, 11775 (Gene ID), AI838160

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23222897

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1769187515.

Ap3b2 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL891, 6475 (ID_REF), GDS1675, BC024722, A_51_P241808 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17691875

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747359716.

Ap3b2 - MPSS transcriptome analysis project

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTCCCCCTCGCCTCT (ID_REF), GDS868, NM_021492

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7473597

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 11141887117.

Ap3b2 - Insm1 deficiency effect on the fetal pituitary gland

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3009184 (ID_REF), GDS5066, NM_021492

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 111418871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7569192218.

Ap3b2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL6481, 102350538 (ID_REF), GDS4002, NM_021492, Ap3b2 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75691922

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7168284919.

Ap3b2 - Fasting effect on multiple tissues: time course

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL11012, 17349 (ID_REF), GDS3893, AB030202

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71682849

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12270472220.

Ap3b2 - Streptozotocin-induced type 1 diabetes model: brain hypothalamus

Annotation:: Ap3b2, adaptor-related protein complex 3, beta 2 subunit

Organism:: Mus musculus

Reporter:: GPL8321, 1426927_at (ID_REF), GDS5344, 11775 (Gene ID), AB030202

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 122704722

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 110

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11775) (2195)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2195

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity