GEO Profile Links for Gene (Select 71564) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1156

<< First< Prev

Page of 58

Next >Last >>

Select item 91860151.

Izumo4 - Skeletal muscle response to voluntary running: time course

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL254, 7466 (ID_REF), GDS1019, AK018541

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9186015

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 234116962.

Izumo4 - Lymphotoxin-beta receptor signaling inhibition effect on lymph nodes: time course (MG-430B)

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL340, 1452809_at (ID_REF), GDS2005, 71564 (Gene ID), AK018541

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 23411696

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162918893.

Izumo4 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2677144 (ID_REF), GDS5172, NM_027829, 9030607L17RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116291889

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 20677904.

Izumo4 - Ligand screen in B cells: neuropeptide Y

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL260, 17453 (ID_REF), GDS314, AK018541

DataSet type:: Expression profiling by array, log ratio, 11 samples

ID:: 2067790

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162513245.

Izumo4 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1256705 (ID_REF), GDS5172, NM_027829, 9030607L17RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116251324

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 552107986.

Izumo4 - Iron enriched and deficient diets effect on the liver

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL4134, 38498 (ID_REF), GDS3373, AK018541, A_51_P425279 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55210798

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1194119137.

Izumo4 - Chronic, low level drug exposure effect on obese liver

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P337427 (ID_REF), GDS5258, NM_027829, A_52_P337427 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119411913

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1291348028.

Izumo4 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P425279 (ID_REF), GDS5629, AK018541, A_51_P425279 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129134802

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 715348029.

Izumo4 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P425279 (ID_REF), GDS3890, AK018541, A_51_P425279 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71534802

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 211819010.

Izumo4 - Ligand screen in B cells: sphingosine-1-phosphate

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL260, 17453 (ID_REF), GDS317, AK018541

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2118190

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7565229211.

Izumo4 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL6481, 450601 (ID_REF), GDS4002, NM_027829, 9030607L17Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75652292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 203419012.

Izumo4 - Ligand screen in B cells: macrophage inflammatory protein-3

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL260, 17453 (ID_REF), GDS312, AK018541

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 2034190

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7562765913.

Izumo4 - High and Low Anxiety: multiple brain regions

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL7467, 6520 (ID_REF), GDS4001, AI847821

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75627659

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 10924839814.

Izumo4 - Diabetic db/db heart response to rosiglitazone

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL4134, 38498 (ID_REF), GDS4990, AK018541, A_51_P425279 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109248398

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13276338915.

Izumo4 - Diet-induced obesity model: liver

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2677144 (ID_REF), GDS6248, NM_027829, 9030607L17RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 51 samples

ID:: 132763389

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12267871316.

Izumo4 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P337427 (ID_REF), GDS5343, NM_027829, A_52_P337427 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122678713

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11939900217.

Izumo4 - Chronic, low level drug exposure effect on obese liver

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P425279 (ID_REF), GDS5258, AK018541, A_51_P425279 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119399002

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749078118.

Izumo4 - MPSS transcriptome analysis project

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGGCTGGGCCGGGA (ID_REF), GDS868, BC057953

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7490781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13035321319.

Izumo4 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL4134, 8213 (ID_REF), GDS5664, NM_027829, A_52_P337427 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130353213

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12707169820.

Izumo4 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Izumo4, IZUMO family member 4

Organism:: Mus musculus

Reporter:: GPL4134, 38498 (ID_REF), GDS5461, AK018541, A_51_P425279 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127071698

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 58

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 71564) (1156)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1156

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity