GEO Profiles Links for Nucleotide (Select 38016186) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 374

<< First< Prev

Page of 19

Next >Last >>

Select item 1193939271.

Zbtb40 - Chronic, low level drug exposure effect on obese liver

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P313779 (ID_REF), GDS5258, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119393927

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728279272.

Zbtb40 - Spatial and temporal development of mammalian salivary glands

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P313779 (ID_REF), GDS3922, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72827927

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 441760873.

Zbtb40 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL891, 10387 (ID_REF), GDS2924, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44176087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 414064504.

Zbtb40 - Nephronophthisis model

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL2897, 121010 (ID_REF), GDS2817, NM_198248

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41406450

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1233156365.

Zbtb40 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2910194 (ID_REF), GDS5360, NM_198248, ZBTB40 (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123315636

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 918090396.

Zbtb40 - Oxidative stress effect on ATF4 knockout embryonic neurons

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL6100, 2100520 (ID_REF), GDS3311, NM_198248

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 91809039

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 459878517.

Zbtb40 - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL4234, 2100520 (ID_REF), GDS2993, NM_198248

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 45987851

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75138598.

Zbtb40 - MPSS transcriptome analysis project

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTGTCGTCCTGAGGA (ID_REF), GDS868, NM_198248

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7513859

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1226607279.

Zbtb40 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P313779 (ID_REF), GDS5343, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 122660727

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7152972710.

Zbtb40 - Interstrain differences in the liver effects of trichloroethylene

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P313779 (ID_REF), GDS3890, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 94 samples

ID:: 71529727

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4692905111.

Zbtb40 - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL4234, 2100520 (ID_REF), GDS3037, NM_198248

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46929051

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1877885012.

Zbtb40 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL2897, 121010 (ID_REF), GDS1729, NM_198248

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18778850

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6196655113.

Zbtb40 - Eset depletion effect on embryonic stem cell

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL6333, scl0230848.1_316-S (ID_REF), GDS3599, NM_198248, BC059177 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61966551

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6434706214.

Zbtb40 - Hypertension model: aorta

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL9734, 100116348_TGI_at (ID_REF), GDS3672, NM_198248

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64347062

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4600681615.

Zbtb40 - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL4234, 104780471 (ID_REF), GDS2993, NM_198248

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 46006816

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11533806716.

Zbtb40 - Glucocorticoid effect on the female liver

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL4134, 40367 (ID_REF), GDS5036, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115338067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11529146717.

Zbtb40 - Glucocorticoid effect on the male liver

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL4134, 40367 (ID_REF), GDS5035, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115291467

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6404042718.

Zbtb40 - SIRT1 deficiency effect on the liver

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P313779 (ID_REF), GDS3666, NM_198248, A_51_P313779 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64040427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12623805519.

Zbtb40 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243330 (ID_REF), GDS5436, NM_198248, BC059177 (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126238055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6529864820.

Zbtb40 - Addictive drugs effect on brain striatum: time course

Annotation:: Zbtb40, zinc finger and BTB domain containing 40

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1243330 (ID_REF), GDS3703, NM_198248

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65298648

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 38016186) (374)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 374

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity