GEO Profile Links for Gene (Select 71242) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1955

<< First< Prev

Page of 98

Next >Last >>

Select item 1162951611.

Spata24 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3103689 (ID_REF), GDS5172, NM_029485, 5133400G04RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116295161

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553762272.

Spata24 - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL891, 527 (ID_REF), GDS3386, NM_027733, A_51_P297388 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55376227

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 47765673.

Spata24 - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL82, 112292_at (ID_REF), GDS606, 71242 (Gene ID), AI850593

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4776567

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162951604.

Spata24 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2427869 (ID_REF), GDS5172, NM_029485, 5133400G04RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116295160

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 940075295.

Spata24 - Gonadal development: ovaries and testes

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1430023_at (ID_REF), GDS4503, 71242 (Gene ID), AK017218

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94007529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 424362296.

Spata24 - Taf7l deficiency effect on the testis

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1430023_at (ID_REF), GDS2857, 71242 (Gene ID), AK017218

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 42436229

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 217363867.

Spata24 - TGF-beta1 effect on renal mesangial cells

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1429580_x_at (ID_REF), GDS1892, 71242 (Gene ID), AK016341

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 21736386

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 216898868.

Spata24 - Glucosamine and high glucose effect on renal mesangial cells

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1429580_x_at (ID_REF), GDS1891, 71242 (Gene ID), AK016341

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 21689886

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129844279.

Spata24 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL891, 527 (ID_REF), GDS1359, NM_027733, A_51_P297388 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12984427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1487748610.

Spata24 - Serum response factor null mutation effect on neonatal cardiomyocytes

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1429580_x_at (ID_REF), GDS1486, 71242 (Gene ID), AK016341

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 14877486

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752268811.

Spata24 - MPSS transcriptome analysis project

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGCGTGCGGTATTCTT (ID_REF), GDS868, NM_027733

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7522688

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12335686012.

Spata24 - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2427869 (ID_REF), GDS5360, NM_029485, 5133400G04RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123356860

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10317012913.

Spata24 - Mitochondrial protease Clpp knockout effect on various tissues

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL11180, 1430023_PM_at (ID_REF), GDS4791, AK017218

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 103170129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4415595914.

Spata24 - Testis response to histone deacetylase inhibitor trichostatin A: time course

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL4053, 1359 (ID_REF), GDS2923, AK017218

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 44155959

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11629515915.

Spata24 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3030392 (ID_REF), GDS5172, NM_029485, 5133400G04RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116295159

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 267106716.

Spata24 - Spermatogenesis time course (MG-U74B)

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL82, 112292_at (ID_REF), GDS409, 71242 (Gene ID), AI850593

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2671067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13271996117.

Spata24 - Diet-induced obesity model: white adipose tissue

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3103689 (ID_REF), GDS6247, NM_029485, 5133400G04RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132719961

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1810852918.

Spata24 - Self-renewing memory B cell

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1430023_at (ID_REF), GDS1695, 71242 (Gene ID), AK017218

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 18108529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7218002919.

Spata24 - Polyubiquitin knockout effect on testis: time course

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1261, 1430023_at (ID_REF), GDS3906, 71242 (Gene ID), AK017218

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72180029

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 463197720.

Spata24 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Spata24, spermatogenesis associated 24

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m07713_at (ID_REF), GDS592, 4930583E11 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4631977

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 98

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 71242) (1955)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1955

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity