GEO Profiles Links for Nucleotide (Select 26332486) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 49

<< First< Prev

Page of 3

Next >Last >>

Select item 1327089041.

Diet-induced obesity model: white adipose tissue

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS6247, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132708904

GEO DataSets Profile neighbors

Select item 303108322.

Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m20068_at (ID_REF), GDS2327, A130093I21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30310832

GEO DataSets Profile neighbors

Select item 1032924043.

MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS4795, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103292404

GEO DataSets Profile neighbors

Select item 826088044.

Effects of high-fat maternal diet and transcription factor Cited2 deficiency on embryos

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS3724, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 82608804

GEO DataSets Profile neighbors

Select item 1312483045.

Snail transcription factor/ERα ligand-binding region chimeric protein effect on embryonic stem cells: time course

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5807, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131248304

GEO DataSets Profile neighbors

Select item 1299473046.

DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5651, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129947304

GEO DataSets Profile neighbors

Select item 75236537.

MPSS transcriptome analysis project

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTCACGTCCAAAGCCA (ID_REF), GDS868, AK038291

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7523653

GEO DataSets

Select item 46443328.

Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m20068_at (ID_REF), GDS592, A130093I21 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4644332

GEO DataSets

Select item 1262591049.

Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5436, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126259104

GEO DataSets Profile neighbors

Select item 12334580410.

Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5360, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123345804

GEO DataSets Profile neighbors

Select item 12179360411.

Lipopolysaccharide effect on fatty acid-loaded peritoneal macrophages in vitro

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5311, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 121793604

GEO DataSets Profile neighbors

Select item 12111860412.

Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5295, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 121118604

GEO DataSets Profile neighbors

Select item 11675650413.

Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5185, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116756504

GEO DataSets Profile neighbors

Select item 11864870414.

20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5237, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118648704

GEO DataSets Profile neighbors

Select item 7464190415.

Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS3974, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74641904

GEO DataSets Profile neighbors

Select item 5461695216.

Skin carcinogenesis model

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL4234, 102650195 (ID_REF), GDS3334, AK038291

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54616952

GEO DataSets Profile neighbors

Select item 7564967317.

High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6481, 102650195 (ID_REF), GDS4002, AK038291, A130093I21Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75649673

GEO DataSets

Select item 11593700418.

Auditory fear conditioning effect on amygdala: time course

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS5157, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115937004

GEO DataSets Profile neighbors

Select item 13224220419.

High-fat diet effect on brown adipose tissue development

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2553041 (ID_REF), GDS6000, AK038291, A130093I21RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132242204

GEO DataSets

Select item 4597525220.

Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130093I21 product:hypothetical protein, full insert sequence