GEO Profile Links for Gene (Select 244550) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 366

<< First< Prev

Page of 19

Next >Last >>

Select item 841014911.

Podnl1 - Chlamydia muridarum genital tract infection model: CD4 T cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS4355, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 84101491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278474832.

Podnl1 - Rhabdomyosarcoma model

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6481, 106370064 (ID_REF), GDS5527, XM_146604, 5832418A03Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127847483

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751130913.

Podnl1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS3987, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75113091

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1194218954.

Podnl1 - Chronic, low level drug exposure effect on obese liver

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P663704 (ID_REF), GDS5258, NM_001013384, A_52_P663704 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119421895

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1256006915.

Podnl1 - MEK inhibitor PD-0325901 and rapamycin combined treatment effect on malignant peripheral nerve sheath tumor model

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS5419, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 125600691

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 755638916.

Podnl1 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS3999, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75563891

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 990541917.

Podnl1 - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS4556, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99054191

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1161545918.

Podnl1 - In vitro-differentiated CD4+ T helper cell subsets

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS5166, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 116154591

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1032929099.

Podnl1 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2822934 (ID_REF), GDS4795, NM_001013384, PODNL1 (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103292909

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763148810.

Podnl1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCCTGAGGCCCTGGA (ID_REF), GDS878, AK077813

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7631488

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10006779111.

Podnl1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS4588, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100067791

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7508339512.

Podnl1 - High-fat dietary restriction effect on epididymal white adipose tissue

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P663704 (ID_REF), GDS3986, NM_001013384, A_52_P663704 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 75083395

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12625960913.

Podnl1 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2822934 (ID_REF), GDS5436, NM_001013384, PODNL1 (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126259609

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12093449514.

Podnl1 - T helper type 9 cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P663704 (ID_REF), GDS5291, NM_001013384, A_52_P663704 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 120934495

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8247920215.

Podnl1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2524657 (ID_REF), GDS3720, XM_146604

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82479202

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10848539116.

Podnl1 - Pyrazinamide effect on pulmonary tuberculosis model : time course

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS4967, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 108485391

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1769688417.

Podnl1 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL891, 11484 (ID_REF), GDS1675, AK077813, A_51_P256968 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17696884

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4417718418.

Podnl1 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL891, 11484 (ID_REF), GDS2924, AK077813, A_51_P256968 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44177184

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11440809119.

Podnl1 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6246, 10573319 (ID_REF), GDS4948, NM_001013384, AK077813, BC063764, DQ303463, chr8:84125989-84132567 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114408091

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12784016320.

Podnl1 - Rhabdomyosarcoma model

Annotation:: Podnl1, podocan-like 1

Organism:: Mus musculus

Reporter:: GPL6481, 100540128 (ID_REF), GDS5527, XM_146604, 5832418A03 (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127840163

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 244550) (366)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 366

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity